alt-r s.p. dcas9 protein v3  (Integrated DNA Technologies)

Journal: PLOS Genetics

Article Title: The circadian clock is disrupted in pancreatic cancer

doi: 10.1371/journal.pgen.1010770

Figure Lengend Snippet: A . The core clock gene Bmal1 was mutated (functional knockout) in KPC murine pancreatic cells with CRISPR-Cas9 genome editing technology (BKO) with the frameshift site indicated by the blue line. B. The frameshift mutation was induced upstream of the basic helix loop helix (bHLH) domain (red star). The resulting protein lacked critical downstream elements for functionality, including the PAS-A, PAS-B, and PAC domains. C. Western blot demonstrating the loss of BMAL1 protein across 24 hours for wild-type (WT) and BKO cells (M = marker lane). D. The mean (± standard error) Per1 mRNA expression of synchronized KPC (n = 3 at each time point; black dashed) and KPC-BKO (n = 3 at each time point; grey) cells from ZT0-ZT24. E. Graphs comparing the percent of cells in G1, S, and G2 in WT (n = 3; white) and BKO (n = 3; grey) KPC cells.

Article Snippet: Ribonucleoproteins were formed with Cas9 protein (V3, Catalog: 1081059, IDT) and ctRNAs individually (ctRNA 1:AATATGCAGAACACCAAGGA, ctRNA 2: TTAGAATATGCAGAACACCA) (IDT).

Techniques: Functional Assay, Knock-Out, CRISPR, Mutagenesis, Western Blot, Marker, Expressing

Journal: Nature Immunology

Article Title: Unconventional human CD61 pairing with CD103 promotes TCR signaling and antigen-specific T cell cytotoxicity

doi: 10.1038/s41590-024-01802-3

Figure Lengend Snippet: a , Overlaid flow cytometry histograms showing downregulation of CD61 expression following serial CD61 siRNA treatment (+25 nM, or 50 nM, or 100 nM treatment) on WT CD61 + T cell (of patient 1). The fifth histogram shows the abrogation of CD61 expression on CD61 KO T cell (dark red) following CRISPR-Cas9 editing of the CD61 gene on WT CD61 + T cell clone (grey). Note the CD61 KO T cell derived from a starting population of 100% CD61 positive cells. The sixth histogram shows WT CD61 + T cell transfected with non-targeting RNPs as control, showing no changes in the CD61 expression. CRISPR-Cas9-mediated CD61 KO T cell demonstrated consistent CD61 abrogation across 4 passages of T cell expansion. b , Overlaid flow cytometry histograms showing phosphorylation level of Zap70 (pY292) on WT CD61 + T cell clone, WT CD61 + T clone treated with 25 nM, 50 nM or 100 nM siRNA, CD61 KO T cell clone, WT CD61 + T cell clone treated with anti-CD61 blocking antibody (PM6/13) and WT CD61 − T cell clone (of patient 1). c , Histogram plots showing Zap70 (pY292) phosphorylation level on CD61 + T cell lines, from 7 different cancer patients following either αCD61 neutralising antibody treatment, IgG isotype control treatment, or no treatment (four patients with NY-ESO-1-specific, and one patient each with SSX-2-specific, Tyrosinase-specific and Melan-A-specific). d . Schematic diagram of in vitro tumour growth assay, with NOD.SCID mice xenografted with NY-ESO-1 + HCT116 tumour at day 0 before adoptive transferred with WT CD61 + or CD61 - T clones (derived from patient 1) at day 2, day 8 and day 14. Tumor volume measurements were taken at intervals, at Day 7, 10, 13, 16 and 20 post xenografts.

Article Snippet: The CRISPR RNP complex was generated with sgRNA (IDT) and Alt-R S. pyogenes Cas9 Nuclease V3 protein (IDT) by incubation at RT for 15–20 min.

Techniques: Flow Cytometry, Expressing, CRISPR, Derivative Assay, Transfection, Blocking Assay, In Vitro, Growth Assay, Clone Assay

Journal: bioRxiv

Article Title: Reducing microtubule detyrosination improves heart function in HCM mice and human iPSC-engineered heart tissues

doi: 10.1101/2023.05.25.542365

Figure Lengend Snippet: SVBP-KO and TTL-KO hiPSC lines were created from a control wild-type hiPSC line (WT, mTag-RFP-T-TUBA1B) with CRISPR/Cas9 genetic tools and differentiated into cardiomyocytes and engineered heart tissues (EHTs). A) Immunofluorescence analysis of 30-day-old SVBP-KO, WT and TTL-KO hiPSC-cardiomyocytes stained for α-actinin 2 (ACTN2, purple), detyrosinated α-tubulin (dTyr-tub, green) and DAPI (blue). Bar scale = 50 μm. B) Western blot and performed on 30-day-old hiPSC-cardiomyocytes (N=3) stained for ACTN2, α-tubulin, dTyr-tub and for GAPDH, as a loading control. Quantification of α-tubulin, dTyr-tub and dTyr-tub/α-tubulin protein levels relative to WT mean. HiPSC-derived cardiomyocytes were cast in EHTs and cultivated for 60 days. Measurements of average peak, force amplitude, time to 50% of peak (TTP 50 ) and time to 50% relaxation (RT 50 ) of 60-day-old EHTs cast on C) standard posts (0.28 mN/mm; WT: N/d = 75/6, SVBP-KO: N/d = 33/5, TTL-KO: N/d = 17/2) or D) afterload enhanced posts (0.8 mN/mm; WT: N/d = 54/6, SVBP-KO: N/d = 33/5, TTL-KO: N/d = 38/5). Data are expressed as mean ± SEM, with P values vs. WT obtained with a one-way ANOVA, followed by a Dunnett’s post-test. Abbreviations: N/d, number of EHTs/differentiations; ns, P>0.1

Article Snippet: Cells were nucleofected using the Amaxa 4D nucleofector (Lonza) with pre-annealed ribonucleoprotein complexes of sgRNAs and recombinant Cas9 protein (IDT, 1081058), single cell clones expanded and genotyped for successful homozygous deletions (Figure S1B).

Techniques: Control, CRISPR, Immunofluorescence, Staining, Western Blot, Derivative Assay